TB-Profiler result

Run: ERR13291000

Summary

Run ID: ERR13291000

Sample name:

Date: 2025-03-07T18:39:29.213171

Number of reads: 6513191

Percentage reads mapped: 99.73

Median coverage: 242.0

Strain: lineage4.9

Spoligotype:

Drug-resistance: RR-TB


Download CSV Download TXT Download JSON
Lineage Table: The lineage is inferred by analysing lineage specific SNPs
Lineage Family RDs Frequency
lineage4 Euro-American None 1.0
lineage4.9 Euro-American (H37Rv-like) None 1.0
Drug resistance: This table reports drug-resistance associated mutations found in known resistance genes
Drug Resistance Supporting mutations WHO confidence Comment
rifampicin rpoB p.Leu430Pro Assoc w R
isoniazid
ethambutol
pyrazinamide
streptomycin
fluoroquinolones
moxifloxacin
ofloxacin
levofloxacin
ciprofloxacin
aminoglycosides
amikacin
capreomycin
kanamycin
cycloserine
ethionamide
clofazimine mmpR5 c.11_63delACGACGGGGTCGATCAGATGGGCGCCGAGCCCGACATCATGGAATTCGTCGAA Assoc w R Can only confer resistance if genetically linked to a functional MmpL5
c.11_63delACGACGGGGTCGATCAGATGGGCGCCGAGCCCGACATCATGGAATTCGTCGAA Assoc w R Can only confer resistance if genetically linked to a functional MmpL5
para-aminosalicylic_acid
delamanid
bedaquiline mmpR5 c.11_63delACGACGGGGTCGATCAGATGGGCGCCGAGCCCGACATCATGGAATTCGTCGAA Assoc w R Can only confer resistance if genetically linked to a functional MmpL5
c.11_63delACGACGGGGTCGATCAGATGGGCGCCGAGCCCGACATCATGGAATTCGTCGAA Assoc w R Can only confer resistance if genetically linked to a functional MmpL5
linezolid
Drug resistance-Associated Mutations: This table reports mutations found in candidate resistance genes which have been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence Comment
rpoB 761095 p.Leu430Pro missense_variant 0.41 rifampicin Assoc w R
mmpR5 778998 c.11_63delACGACGGGGTCGATCAGATGGGCGCCGAGCCCGACATCATGGAATTCGTCGAA frameshift_variant 0.98 bedaquiline Assoc w R Can only confer resistance if genetically linked to a functional MmpL5
clofazimine Assoc w R Can only confer resistance if genetically linked to a functional MmpL5
mmpR5 778998 c.11_63delACGACGGGGTCGATCAGATGGGCGCCGAGCCCGACATCATGGAATTCGTCGAA frameshift_variant 1.0 bedaquiline Assoc w R Can only confer resistance if genetically linked to a functional MmpL5
clofazimine Assoc w R Can only confer resistance if genetically linked to a functional MmpL5
Non-Associated Mutations: This table reports mutations found in candidate resistance genes which have not been associated with drug resistance
Gene Chromosome position Mutation Type Estimated fraction Drugs Confidence
gyrA 7362 p.Glu21Gln missense_variant 1.0 levofloxacin Not assoc w R
moxifloxacin Not assoc w R
Rv0010c 13636 c.-78A>C upstream_gene_variant 0.35 isoniazid Uncertain significance
mmpL5 775639 p.Ile948Val missense_variant 1.0 bedaquiline Not assoc w R - Interim
clofazimine Not assoc w R
rpsL 781395 c.-165T>C upstream_gene_variant 1.0 streptomycin Not assoc w R
rrs 1471659 n.-187C>T upstream_gene_variant 1.0 amikacin Uncertain significance
capreomycin Uncertain significance
kanamycin Uncertain significance
streptomycin Uncertain significance
tlyA 1918496 p.Glu186Ala missense_variant 1.0 capreomycin Uncertain significance
Rv1979c 2223293 c.-129A>G upstream_gene_variant 1.0 bedaquiline Not assoc w R - Interim
clofazimine Not assoc w R
Rv1979c 2223724 c.-560C>G upstream_gene_variant 1.0 bedaquiline Uncertain significance
clofazimine Uncertain significance
Rv2752c 3064726 p.Ala489Val missense_variant 1.0 ethambutol Uncertain significance
isoniazid Uncertain significance
levofloxacin Uncertain significance
moxifloxacin Uncertain significance
rifampicin Uncertain significance
whiB6 4338595 c.-75delG upstream_gene_variant 1.0 amikacin Not assoc w R
capreomycin Not assoc w R
kanamycin Not assoc w R